WormMine: Gene WBGene00133516

• WormBase Gene ID: WBGene00133516
• Gene Name: CJA14312
• Sequence Name: CJA14312
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP:ADP antiporter activity. Predicted to be involved in mitochondrial ADP transmembrane transport and mitochondrial ATP transmembrane transport. Predicted to be located in mitochondrial inner membrane. Is an ortholog of C. elegans ant-1.3 and ant-1.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14312.1	CJA14312.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14312	CJA14312		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070490
• Remark: CJA14312, ATTATGTACAAGAACACGTGGGATTGCGCTGTCAAGATTGTCAAGAACGAGGGAATGGCT, WBGene00133516
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term