WormMine: Gene WBGene00134105

• WormBase Gene ID: WBGene00134105
• Gene Name: Cjp-tmc-1
• Sequence Name: CJA14901
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be located in plasma membrane. Is an ortholog of C. elegans tmc-1. In C. elegans, tmc-1 is involved in detection of stimulus involved in sensory perception; monoatomic ion transmembrane transport; and sensory perception of chemical stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14901.1	CJA14901.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14901	CJA14901		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070810
• Remark: CJA14901, TCATCCAAGAAACGCTTCAGAATATCCGTTTCCCCCACAAAAAGCATAGTTCCCTCTTCA, WBGene00134105
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term