WormMine: Gene WBGene00134210

• WormBase Gene ID: WBGene00134210
• Gene Name: CJA15006
• Sequence Name: CJA15006
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable hydrolase activity. Predicted to be involved in lipid catabolic process. Is an ortholog of C. elegans D1054.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15006a.1	CJA15006a.1		[unknown]
Transcript:CJA15006c.1	CJA15006c.1		[unknown]
Transcript:CJA15006b.1	CJA15006b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15006c	CJA15006c		[unknown]
CDS:CJA15006b	CJA15006b		[unknown]
CDS:CJA15006a	CJA15006a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077605
• Remark: CJA15006, GCTTTGTTTCCTCCGTCTCGGAACATCCTAAAACAATACTATCAAATGGGCCATGATGAT, WBGene00134210
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term