WormMine: Gene WBGene00134493

• WormBase Gene ID: WBGene00134493
• Gene Name: Cjp-lpd-7
• Sequence Name: CJA15289
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in ribosome biogenesis. Predicted to be located in nucleolus. Is an ortholog of C. elegans lpd-7. In C. elegans, lpd-7 is involved in lipid storage.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15289.1	CJA15289.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15289	CJA15289		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078074
• Remark: Cjp-lpd-7, GCGAGTTGATGATCTCGAAGAAGCACCAACGAGTGTATCACAGCATGAAGACGCAGTTTA, WBGene00134493
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term