WormMine: Gene WBGene00134646

• WormBase Gene ID: WBGene00134646
• Gene Name: Cjp-cpd-2
• Sequence Name: CJA15442
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metallocarboxypeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans cpd-2. In C. elegans, cpd-2 is involved in regulation of muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15442.1	CJA15442.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15442	CJA15442		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074963
• Remark: CJA15442, AGAGCTAAAATAGTGGTTAGCTACGGGGAAGGAGAGTTTTGGCGATTGGCCAACATTGGC, WBGene00134646
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term