WormMine: Gene WBGene00134707

• WormBase Gene ID: WBGene00134707
• Gene Name: Cjp-mom-2
• Sequence Name: CJA15503
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable G protein-coupled receptor activity and signaling receptor binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway and Wnt signaling pathway. Predicted to be located in extracellular region and membrane. Is an ortholog of C. elegans mom-2. In C. elegans, mom-2 is involved in several processes, including cell differentiation; left/right axis specification; and neuroblast migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15503a.1	CJA15503a.1		[unknown]
Transcript:CJA15503b.1	CJA15503b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15503a	CJA15503a		[unknown]
CDS:CJA15503b	CJA15503b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074112
• Remark: Cjp-mom-2, AAATTGTCGACGAGCCGTGCCACTGTCAATTTGTTTGGTGCTGTGAGGTAAAGTGCAAAA, WBGene00134707
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term