WormMine: Gene WBGene00134931

• WormBase Gene ID: WBGene00134931
• Gene Name: CJA15727
• Sequence Name: CJA15727
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable acid phosphatase activity and metal ion binding activity. Is an ortholog of C. elegans C08B6.14.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15727b.1	CJA15727b.1		[unknown]
Transcript:CJA15727a.1	CJA15727a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15727a	CJA15727a		[unknown]
CDS:CJA15727b	CJA15727b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074424
• Remark: CJA15727, GCAAAGATGTTGGGCATCGGCACAGTGAAGAGATGCGGATTGATGGGGAGAAGTTTTATT, WBGene00134931
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term