WormMine: Gene WBGene00135076

• WormBase Gene ID: WBGene00135076
• Gene Name: Cjp-cat-1
• Sequence Name: CJA15872
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in transmembrane transport. Is an ortholog of C. elegans cat-1. In C. elegans, cat-1 is involved in dopamine metabolic process; feeding behavior; and monoamine transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15872a.1	CJA15872a.1		[unknown]
Transcript:CJA15872b.1	CJA15872b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15872b	CJA15872b		[unknown]
CDS:CJA15872a	CJA15872a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089127
• Remark: Cjp-cat-1, TGGAACTAACATTTTTGGACCCCTTGCTCACCGCATGGGAAGGTCAGACAAAACTTTAAA, WBGene00135076
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term