WormMine: Gene WBGene00135395

• WormBase Gene ID: WBGene00135395
• Gene Name: Cjp-zyg-9
• Sequence Name: CJA16191
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be located in ribosome. Is an ortholog of C. elegans zyg-9. In C. elegans, zyg-9 is involved in embryo development; meiotic spindle organization; and spindle elongation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16191a.1	CJA16191a.1		[unknown]
Transcript:CJA16191b.1	CJA16191b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16191b	CJA16191b		[unknown]
CDS:CJA16191a	CJA16191a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081361
• Remark: Cjp-zyg-9, AAGAAAACGCTAAAAACACTGATTCCCCTGCTCATCAAACATTCGGGTGACTCGGATTCG, WBGene00135395
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term