WormMine: Gene WBGene00135456

• WormBase Gene ID: WBGene00135456
• Gene Name: Cjp-gap-2
• Sequence Name: CJA16252
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Rho GTPase activation protein; GTPase-activator protein for Ras-like GTPase; Ras GTPase-activating domain; C2 domain; Ras GTPase-activating protein; and C2 domain superfamily. Is an ortholog of C. elegans gap-2. In C. elegans, gap-2 is involved in learning or memory and negative regulation of Ras protein signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16252.1	CJA16252.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16252	CJA16252		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078887
• Remark: Cjp-gap-2, TACAATATCCCAGCTGAACCAAAGGAAGTGGTGTATCAAAAACGTTCGAGTCCCCCACCA, WBGene00135456
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term