WormMine: Gene WBGene00135781

• WormBase Gene ID: WBGene00135781
• Gene Name: Cjp-rpl-1
• Sequence Name: CJA16576
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be part of large ribosomal subunit. Is an ortholog of C. elegans rpl-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16576.2	CJA16576.2		[unknown]
Transcript:CJA16576.1	CJA16576.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16576	CJA16576		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082840
• Remark: Cjp-rpl-1, TCTCGCTCTTGAAGAAGAACTGGCAAAACGTTAGATCGTTGAACATCAAGTCCACCATGG, WBGene00135781
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term