WormMine: Gene WBGene00136370

• WormBase Gene ID: WBGene00136370
• Gene Name: Cjp-sod-1
• Sequence Name: CJA17167
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable copper ion binding activity. Predicted to be involved in superoxide metabolic process. Is an ortholog of C. elegans sod-1. In C. elegans, sod-1 is involved in regulation of brood size; regulation of vulval development; and removal of superoxide radicals.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17167.1	CJA17167.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17167	CJA17167		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076455
• Remark: Cjp-sod-5, GAAACGTTGAAGCTGGAGCGGATGGTGTCGCCAAGGTGAACATCACTGACAAGTTTATCA, WBGene00136370
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term