WormMine: Gene WBGene00136759

• WormBase Gene ID: WBGene00136759
• Gene Name: Cjp-egl-15
• Sequence Name: CJA17555
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein tyrosine kinase activity. Is an ortholog of C. elegans egl-15. In C. elegans, egl-15 is involved in several processes, including egg-laying behavior; muscle cell cellular homeostasis; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17555.1	CJA17555.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17555	CJA17555		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074029
• Remark: Cjp-egl-15, GACCAGTTTCTCCGATAGATTCATTCCACAAGAAAAGGAAGCATCGACCACTCTCAGCAC, WBGene00136759
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term