WormMine: Gene WBGene00137004

• WormBase Gene ID: WBGene00137004
• Gene Name: Cjp-pab-1
• Sequence Name: CJA17800
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans pab-1. In C. elegans, pab-1 is involved in several processes, including gamete generation; positive regulation of developmental process; and regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17800.1	CJA17800.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17800	CJA17800		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074978
• Remark: Cjp-pab-1, ACAAGGAAGCTGGTAAGATCACTGGAATGATGCTCGAAATCGACAACTCTGAGCTCATCA, WBGene00137004
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term