WormMine: Gene WBGene00137689

• WormBase Gene ID: WBGene00137689
• Gene Name: Cjp-algn-2
• Sequence Name: CJA18484
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable GDP-Man:Man1GlcNAc2-PP-Dol alpha-1,3-mannosyltransferase activity. Predicted to be involved in protein glycosylation. Is an ortholog of C. elegans algn-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18484.1	CJA18484.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18484	CJA18484		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082651
• Remark: CJA18484, AAGTCACGTTCCTTCGCTCGCCATCCGACGAGAGAAAAGTGAATTTGATTCGAAAAAGTC, WBGene00137689
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term