WormMine: Gene WBGene00137993

• WormBase Gene ID: WBGene00137993
• Gene Name: Cjp-mca-1
• Sequence Name: CJA18790
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and P-type calcium transporter activity. Predicted to be involved in calcium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans mca-1. In C. elegans, mca-1 is involved in calcium ion transport and intracellular calcium ion homeostasis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18790.1	CJA18790.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18790	CJA18790		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081049
• Remark: Cjp-mca-1, AAGGCAGCGAATTCAACGAGCGCATCCGCGACGAGAACGGCAAAGTGTCACAGGCGAAAC, WBGene00137993
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term