WormMine: Gene WBGene00138069

• WormBase Gene ID: WBGene00138069
• Gene Name: Cjp-egl-18
• Sequence Name: CJA18864
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans egl-18. In C. elegans, egl-18 is involved in cell fate specification; membrane fusion; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18864a.1	CJA18864a.1		[unknown]
Transcript:CJA18864b.1	CJA18864b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18864b	CJA18864b		[unknown]
CDS:CJA18864a	CJA18864a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071699
• Remark: Cjp-egl-18, TTCAATCAGCTGCTCACTCAACTGCCTCAGATGACGACGGGCGGATCGCCAGGAGCCACA, WBGene00138069
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term