WormMine: Gene WBGene00138483

• WormBase Gene ID: WBGene00138483
• Gene Name: CJA19280
• Sequence Name: CJA19280
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and ATP-dependent chromatin remodeler activity. Is an ortholog of C. elegans F53H4.6 and csb-1. In C. elegans, csb-1 is involved in UV protection and transcription-coupled nucleotide-excision repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19280.1	CJA19280.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19280	CJA19280		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076410
• Remark: CJA19280, GCACATAATAAAATTGTGGAAAAGACGTCGAATCCCTCTCTGGTCATCGTTCCACTACCT, WBGene00138483
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term