WormMine: Gene WBGene00177546

• WormBase Gene ID: WBGene00177546
• Gene Name: CJA21974
• Sequence Name: CJA21974
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA21974c.1	CJA21974c.1		[unknown]
Transcript:CJA21974b.1	CJA21974b.1		[unknown]
Transcript:CJA21974a.1	CJA21974a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA21974c	CJA21974c		[unknown]
CDS:CJA21974b	CJA21974b		[unknown]
CDS:CJA21974a	CJA21974a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076889
• Remark: CJA21974, CACCTCCGATCAGAGCTTTCCGGAAGAGTTAAATGCTTATCCACAGTTACAACAAATCGG, WBGene00177546
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term