WormMine: Gene WBGene00179945

• WormBase Gene ID: WBGene00179945
• Gene Name: CJA24373
• Sequence Name: CJA24373
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans mls-1. In C. elegans, mls-1 is involved in muscle cell fate specification and post-embryonic development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA24373.1	CJA24373.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA24373	CJA24373		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072056
• Remark: CJA24373, GGAGTGTATCGAGATGAAACGGTTTCGCTACTCGTTTCACCAATCAAAGTGGATTTCTAC, WBGene00179945
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term