WormMine: Gene WBGene00180042

• WormBase Gene ID: WBGene00180042
• Gene Name: CJA24470
• Sequence Name: CJA24470
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable hydroxyacylglutathione hydrolase activity. Predicted to be involved in methylglyoxal catabolic process to D-lactate via S-lactoyl-glutathione. Is an ortholog of C. elegans Y17G7B.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA24470a.1	CJA24470a.1		[unknown]
Transcript:CJA24470b.1	CJA24470b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA24470b	CJA24470b		[unknown]
CDS:CJA24470a	CJA24470a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076303
• Remark: CJA24470, GAGAAATTGACGAATCCATTCATGAGGGTGCGAAGTTCGGAGGAAATTCAGAAGACGTTG, WBGene00180042
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term