WormMine: Gene WBGene00181018

• WormBase Gene ID: WBGene00181018
• Gene Name: CJA25446
• Sequence Name: CJA25446
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ribonuclease III activity. Predicted to be involved in RNA processing. Is an ortholog of C. elegans dcr-1. In C. elegans, dcr-1 is involved in several processes, including gonad morphogenesis; nucleobase-containing compound metabolic process; and olfactory learning.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA25446b.1	CJA25446b.1		[unknown]
Transcript:CJA25446a.1	CJA25446a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA25446a	CJA25446a		[unknown]
CDS:CJA25446b	CJA25446b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071633
• Remark: Cjp-dcr-1, GCGATCCGCTCTTGTCAATAACACGATTTTCGCGTCACTGGCGGTGAAGTATGAGTTTCA, WBGene00137516
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term