WormMine: Gene WBGene00208110

• WormBase Gene ID: WBGene00208110
• Gene Name: Cjp-cope-1.3
• Sequence Name: CJA32263
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable structural molecule activity. Predicted to be involved in retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum. Is an ortholog of C. elegans cope-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA32263a.1	CJA32263a.1		[unknown]
Transcript:CJA32263b.1	CJA32263b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA32263b	CJA32263b		[unknown]
CDS:CJA32263a	CJA32263a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072021
• Remark: CJA20041, ATAAGGATGCTGATGTGCTTATCAACTCACTTGTTGCTGCTCAGTACAATGATAAGGATG, WBGene00175612
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term