WormMine: Gene WBGene00209073

• WormBase Gene ID: WBGene00209073
• Gene Name: CJA33226
• Sequence Name: CJA33226
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP hydrolysis activity; ATPase-coupled intramembrane lipid transporter activity; and small molecule binding activity. Predicted to be involved in phospholipid transport. Predicted to be located in membrane. Is an ortholog of C. elegans tat-4. In C. elegans, tat-4 is involved in sterol metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33226b.1	CJA33226b.1		[unknown]
Transcript:CJA33226a.1	CJA33226a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33226a	CJA33226a		[unknown]
CDS:CJA33226b	CJA33226b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083289
• Remark: Cjp-tat-4, GAATCGCTGGAAAAGAGGGGTTACAGGCAGCAATGGCTTGTGACTTTGCCATTGCTAGAT, WBGene00123166
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term