WormMine: Gene WBGene00209096

• WormBase Gene ID: WBGene00209096
• Gene Name: Cjp-xpf-1
• Sequence Name: CJA33249
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity and nuclease activity. Is an ortholog of C. elegans xpf-1. In C. elegans, xpf-1 is involved in DNA damage response; meiotic nuclear division; and regulation of multicellular organismal development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33249.1	CJA33249.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33249	CJA33249		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077756
• Remark: CJA14970, CGTGATCGACGAGGACAAATTTCGGATAAACAACAACGTCTGCTGAATGATATTATGTCG, WBGene00134174
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term