WormMine: Gene WBGene00209593

• WormBase Gene ID: WBGene00209593
• Gene Name: CJA33746
• Sequence Name: CJA33746
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in ubiquitin-dependent protein catabolic process. Is an ortholog of C. elegans skr-1; skr-2; and skr-6. In C. elegans, skr-1 is involved in several processes, including negative regulation of intracellular signal transduction; regulation of cellular component organization; and regulation of protein stability.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33746.1	CJA33746.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33746	CJA33746		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089844
• Remark: Cjp-skr-1, AATATCAAAAATGACTTCACTCCGGAGGAGGAGGAGCAGATTCGCAAGGAGAACGCTTGG, WBGene00128909
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term