WormMine: Gene WBGene00211028

• WormBase Gene ID: WBGene00211028
• Gene Name: Cjp-rars-1.1
• Sequence Name: CJA35181
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and arginine-tRNA ligase activity. Predicted to be involved in arginyl-tRNA aminoacylation. Is an ortholog of C. elegans rars-1. In C. elegans, rars-1 is involved in determination of adult lifespan; regulation of gene expression; and translation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA35181b.1	CJA35181b.1		[unknown]
Transcript:CJA35181a.1	CJA35181a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA35181a	CJA35181a		[unknown]
CDS:CJA35181b	CJA35181b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090395
• Remark: Cjp-rars-1, ACTCGCCCTGTGCGATGTGACCGCCAACGTCATCTCGAAATGTTTCGAAATTCTTGGCAT, WBGene00123593
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term