WormMine: Gene WBGene00213961

• WormBase Gene ID: WBGene00213961
• Gene Name: CJA38114
• Sequence Name: CJA38114
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable oxidoreductase activity. Is an ortholog of C. elegans tyr-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38114c.1	CJA38114c.1		[unknown]
Transcript:CJA38114b.1	CJA38114b.1		[unknown]
Transcript:CJA38114a.1	CJA38114a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38114c	CJA38114c		[unknown]
CDS:CJA38114b	CJA38114b		[unknown]
CDS:CJA38114a	CJA38114a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090207
• Remark: Cjp-tyr-4, AGTGGCGAGTGCACAAAGAACACCCTTTGGATGACTGAAAATTGCCGAAAGAGTTGCTCA, WBGene00135716
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term