WormMine: Gene WBGene00214788

• WormBase Gene ID: WBGene00214788
• Gene Name: CJA38941
• Sequence Name: CJA38941
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be an extracellular matrix structural constituent. Predicted to be part of collagen trimer.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38941a.1	CJA38941a.1		[unknown]
Transcript:CJA38941b.1	CJA38941b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38941b	CJA38941b		[unknown]
CDS:CJA38941a	CJA38941a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078179
• Remark: Cjp-emb-9, GATCAGGACAAGCAGTTCCGCAAGCCAATGTCGCAGACGCTCAAGGCCGGAGGACTCAAG, WBGene00130026
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term