WormMine: Gene WBGene00215428

• WormBase Gene ID: WBGene00215428
• Gene Name: CJA39581
• Sequence Name: CJA39581
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein disulfide isomerase activity. Is an ortholog of C. elegans C14B9.2. In C. elegans, C14B9.2 is involved in IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA39581.1	CJA39581.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA39581	CJA39581		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083876
• Remark: CJA01074, CGACACCCATCAAATACTCTGGAAACCGCGACTTGGAAGACTTGAAAAAGTTTATGGCGA, WBGene00120278
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term