WormMine: Gene WBGene00216109

• WormBase Gene ID: WBGene00216109
• Gene Name: Cjp-lpd-6.2
• Sequence Name: CJA40261
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable rRNA binding activity. Predicted to be involved in rRNA processing. Is an ortholog of C. elegans lpd-6. In C. elegans, lpd-6 is involved in lipid storage.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA40261.1	CJA40261.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA40261	CJA40261		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084738
• Remark: Cjp-lpd-6, AGAAAAAACATCTCGCTCTCGTCCAGACTTTCATGCAGAACATGTTTCCGTCGATTAATG, WBGene00136750
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term