WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042649 Gene Name  CBG24571
Sequence Name  ? CBG24571 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Brain protein I3. Is an ortholog of C. elegans F11G11.5. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24571.2 CBG24571.2   [unknown]
Transcript:CBG24571.1 CBG24571.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24571 CBG24571   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00134337
WBVar00134338
WBVar00134339

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dnj-9, GATTGATGTGACGGTCCCTCTTCAAGCAATGGTTAATGATAGCCAACTCCGCGTATATAC, WBGene00042650   Expr1057329 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG24571, AATCTTCACATTCCCATTCGGACTAATTTTCCTTTGTTGTATTCCATGTACTGTTCAAAA, WBGene00042649   Expr1057017 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term