WormMine: Gene WBGene00042516

• WormBase Gene ID: WBGene00042516
• Gene Name: CBG24392
• Sequence Name: CBG24392
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-conjugating enzyme; Ubiquitin-conjugating enzyme E2; and Ubiquitin-conjugating enzyme/RWD-like. Is an ortholog of C. elegans ubc-19.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24392.1	CBG24392.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24392	CBG24392		[unknown]

0 RNAi Result

122 Allele

• WBVar00134201
• WBVar00134202
• WBVar00134203
• WBVar00134204
• WBVar00134205
• WBVar00134200
• WBVar00134168
• WBVar00134169
• WBVar00134170
• WBVar00134171
• WBVar00134172
• WBVar00134173
• WBVar00134174
• WBVar00134175
• WBVar00134176
• WBVar00134177
• WBVar00134178
• WBVar00134179
• WBVar00134180
• WBVar00134181
• WBVar00134182
• WBVar00134183
• WBVar00134184
• WBVar00134185
• WBVar00134186
• WBVar00134187
• WBVar00134188
• WBVar00134189
• WBVar00134146
• WBVar00134147

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061596
• Remark: Cbr-ubc-19, CCCGTTTGGATCGCGAAAAACACGGAATCGAACCTTTGGATTTGAGCATAATTTCAGTAG, WBGene00039652
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term