WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042475 Gene Name  CBG24340
Sequence Name  ? CBG24340 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Kringle; Kringle domain; Kringle superfamily; and Kringle-like fold. Is an ortholog of C. elegans T22A3.6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24340.1 CBG24340.1   [unknown]
Transcript:CBG24340.2 CBG24340.2   [unknown]
Transcript:CBG24340.3 CBG24340.3   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24340 CBG24340   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00134024

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG24341, ATACTTTGACTGTTGTCTTTCCAGAAGTTTCAAATCCCACGACGACTGCAACGAATATAA, WBGene00042476   Expr1062094 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG24340, TGAAACATTTCATTTATACCATGATCTTCTTTTCAACGATCCTTCTCAGTTTTTCGTAGA, WBGene00042475   Expr1062779 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG24342, CAAAGAAGAACTCGTGCAGCTGACCAACTTCTCAGACAATCGTCCAATTGACATCGTGAC, WBGene00042477   Expr1053003 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term