WormMine: Gene WBGene00026477

• WormBase Gene ID: WBGene00026477
• Gene Name: Cbr-madf-3
• Sequence Name: CBG03666
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WSTF, HB1, Itc1p, MBD9 motif 1; Bromodomain; WHIM2 domain; Zinc finger, PHD-type; Williams-Beuren syndrome DDT (WSD), D-TOX E motif; Zinc finger, RING/FYVE/PHD-type; ATP-utilising chromatin assembly and remodelling N-terminal; WSTF/Acf1/Cbp146; WHIM1 domain; Bromodomain-like superfamily; DDT domain; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans madf-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03666.1	CBG03666.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03666	CBG03666		[unknown]

0 RNAi Result

18 Allele

• WBVar00136070
• WBVar00136071
• WBVar00136072
• WBVar00136073
• WBVar00136074
• WBVar00136075
• WBVar00136076
• WBVar00136077
• WBVar00136078
• WBVar00136061
• WBVar00136062
• WBVar00136063
• WBVar00136064
• WBVar00136065
• WBVar00136066
• WBVar00136067
• WBVar00136068
• WBVar00136069

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067957
• Remark: CBG03666, CAAGGGAAATGTAAGAGTTGTCGAAAGAAGGCGTCGGCTCATGATTTGATTCTATGCTCC, WBGene00026477
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term