WormMine: Gene WBGene00024213

• WormBase Gene ID: WBGene00024213
• Gene Name: CBG00897
• Sequence Name: CBG00897
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily and Leucine-rich repeat, cysteine-containing subtype. Is an ortholog of C. elegans T01E8.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00897.1	CBG00897.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00897	CBG00897		[unknown]

0 RNAi Result

6 Allele

• WBVar00135662
• WBVar00135663
• WBVar00135664
• WBVar00041612
• WBVar00041617
• WBVar00041622

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063826
• Remark: CBG00897, GAAGACCCAAATTTTCAGACGCCGCACTTCAATGTTTGAGGGATTGTGTATTCAGAAGGT, WBGene00024213
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term