WormMine: Gene WBGene00023716

• WormBase Gene ID: WBGene00023716
• Gene Name: Cbr-lron-9
• Sequence Name: CBG00306
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 and Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Leucine-rich repeat; Leucine-rich repeat, typical subtype; Leucine Rich Repeat; Leucine rich repeat; and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans lron-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00306.1	CBG00306.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00306	CBG00306		[unknown]

0 RNAi Result

22 Allele

• WBVar00135548
• WBVar00135549
• WBVar00135550
• WBVar00135551
• WBVar00141119
• WBVar00039339
• WBVar00061178
• WBVar00061183
• WBVar00061188
• WBVar00061193
• WBVar00061198
• WBVar00061203
• WBVar00061208
• WBVar00061213
• WBVar00061218
• WBVar00061223
• WBVar00061228
• WBVar00061233
• WBVar00061238
• WBVar00061243
• WBVar00061248
• WBVar00061253

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1055787
• Remark: CBG00306, GCGATCGTCCGTATACACTAAGAGGAGAGGCTATTCTACAAGTGGAACCAGAGAAATTCC, WBGene00023716
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term