WormMine: Gene WBGene00036383

• WormBase Gene ID: WBGene00036383
• Gene Name: Cbr-otub-3
• Sequence Name: CBG16450
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: OTU domain; Papain-like cysteine peptidase superfamily; and OTU-like cysteine protease. Is an ortholog of C. elegans otub-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16450b.1	CBG16450b.1		[unknown]
Transcript:CBG16450a.1	CBG16450a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16450b	CBG16450b		[unknown]
CDS:CBG16450a	CBG16450a		[unknown]

0 RNAi Result

6 Allele

• WBVar00138370
• WBVar00138372
• WBVar00138371
• WBVar00138367
• WBVar00138369
• WBVar00138368

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067508
• Remark: CBG16450, GCGTTTGGGGTGGAGAGCTCGAGTTGACAGCCATTTCACAGCACTATAAGAAGGTTATTC, WBGene00036383
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term