WormMine: Gene WBGene00035969

• WormBase Gene ID: WBGene00035969
• Gene Name: CBG15848
• Sequence Name: CBG15848
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: V0 complex accessory subunit Ac45.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15848a.1	CBG15848a.1		[unknown]
Transcript:CBG15848b.1	CBG15848b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15848b	CBG15848b		[unknown]
CDS:CBG15848a	CBG15848a		[unknown]

0 RNAi Result

8 Allele

• WBVar00138303
• WBVar00138302
• WBVar00138305
• WBVar00138304
• WBVar00138307
• WBVar00138306
• WBVar00138309
• WBVar00138308

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050906
• Remark: CBG15848, TGCTCCAATCGATAAAGACGCCCGATCGATTCGATGACCCAAAGAAGACCAAGCAAATTG, WBGene00035969
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term