WormMine: Gene WBGene00034397

• WormBase Gene ID: WBGene00034397
• Gene Name: CBG13660
• Sequence Name: CBG13660
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF684 and Protein of unknown function (DUF684). Is an ortholog of C. elegans K02E7.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13660.1	CBG13660.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13660	CBG13660		[unknown]

0 RNAi Result

9 Allele

• WBVar00137766
• WBVar00137768
• WBVar00137767
• WBVar00137769
• WBVar00137771
• WBVar00137770
• WBVar00137773
• WBVar00137772
• WBVar00137774

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly decreased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_downregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1066099
• Remark: CBG13660, AAACCCACATATCCAATGTGGTGACATCTATCAAGGATTGTGCAGATGTTGGAATGTACA, WBGene00034397
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term