WormMine: Gene WBGene00040908

• WormBase Gene ID: WBGene00040908
• Gene Name: Cbr-pin-2
• Sequence Name: CBG22312
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: LIM domain; Zinc finger, LIM-type; and LIM and senescent cell antigen-like-containing domain protein 1-like. Is an ortholog of C. elegans pin-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22312.1	CBG22312.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22312	CBG22312		[unknown]

0 RNAi Result

4 Allele

• WBVar00139868
• WBVar00139866
• WBVar00139867
• WBVar00003969

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064128
• Remark: Cbr-pin-2, TTCATCTATTCGGAAAGGCATTTTGTCTCAGCTGCTACAGATGTCGAGGGTGTGATAAAA, WBGene00040908
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term