WormMine: Gene WBGene00040854

• WormBase Gene ID: WBGene00040854
• Gene Name: CBG22250
• Sequence Name: CBG22250
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Transmembrane protein 26. Is an ortholog of C. elegans Y119C1B.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22250a.1	CBG22250a.1		[unknown]
Transcript:CBG22250b.1	CBG22250b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22250a	CBG22250a		[unknown]
CDS:CBG22250b	CBG22250b		[unknown]

0 RNAi Result

15 Allele

• WBVar00033562
• WBVar00033532
• WBVar00033567
• WBVar00033537
• WBVar00033572
• WBVar00033542
• WBVar00033512
• WBVar00033577
• WBVar00033547
• WBVar00033517
• WBVar00033582
• WBVar00033552
• WBVar00033522
• WBVar00033557
• WBVar00033527

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063578
• Remark: CBG22250, GAAGCATTTCCGAAGAACGTGAGCAATTGTTCCCCCGCCATCATGGACGAAGAATGGATC, WBGene00040854
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term