WormMine: Gene WBGene00040826

• WormBase Gene ID: WBGene00040826
• Gene Name: Cbr-tub-2
• Sequence Name: CBG22218
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tubby, C-terminal; WD40/YVTN repeat-like-containing domain superfamily; Tub family; WD40 repeat; and Tubby-like, C-terminal. Is an ortholog of C. elegans tub-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22218.1	CBG22218.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22218	CBG22218		[unknown]

0 RNAi Result

4 Allele

• WBVar00131244
• WBVar00131245
• WBVar00131242
• WBVar00131243

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054108
• Remark: Cbr-tub-2, CAAAACAAGTTCTGCAATTTGGCAGAATCGAAGGCGGCGCCTATACACTCGACTTCCGAT, WBGene00040826
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term