WormMine: Gene WBGene00040806

• WormBase Gene ID: WBGene00040806
• Gene Name: CBG22191
• Sequence Name: CBG22191
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: B30.2/SPRY domain superfamily; Zinc finger, RING/FYVE/PHD-type; Zinc finger, C3HC4 type (RING finger); Concanavalin A-like lectin/glucanase domain superfamily; and SPRY domain. Is an ortholog of C. elegans F16A11.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22191.1	CBG22191.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22191	CBG22191		[unknown]

0 RNAi Result

18 Allele

• WBVar00131232
• WBVar00131233
• WBVar00131230
• WBVar00131231
• WBVar00131236
• WBVar00131237
• WBVar00131234
• WBVar00131235
• WBVar00131238
• WBVar00131239
• WBVar00131224
• WBVar00131225
• WBVar00131222
• WBVar00131223
• WBVar00131228
• WBVar00131229
• WBVar00131226
• WBVar00131227

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1069236
• Remark: CBG22191, TGCCCTCTGTGTCGTACGCCAATCGTAGAACGTGTCCCAATGAAAACCAACAACAACAAG, WBGene00040806
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term