WormMine: Gene WBGene00040663

• WormBase Gene ID: WBGene00040663
• Gene Name: CBG22017
• Sequence Name: CBG22017
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: SEA domain superfamily and SEA domain. Is an ortholog of C. elegans Y48G1BR.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22017.1	CBG22017.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22017	CBG22017		[unknown]

0 RNAi Result

6 Allele

• WBVar00015834
• WBVar00130945
• WBVar00130947
• WBVar00130946
• WBVar00130949
• WBVar00130948

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1069387
• Remark: CBG22017, ACGGTACCACACCTCGTCCATCCTCTCAAAAACCGGGACCAATCACAAAAATGCAAATCG, WBGene00040663
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term