Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG21949.1 | CBG21949.1 | [unknown] |
Other
9 Allele
Public Name |
---|
WBVar00032972 |
WBVar00032957 |
WBVar00032942 |
WBVar00032977 |
WBVar00032962 |
WBVar00032947 |
WBVar00032982 |
WBVar00032967 |
WBVar00032952 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG21949, CTACACAACCAACTACAGTAATCAAAACTACAGTAATCCCCTCGACATCTGCCTCCTCTA, WBGene00040613 | Expr1062301 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |