WormMine: Gene WBGene00042112

• WormBase Gene ID: WBGene00042112
• Gene Name: Cbr-sdz-34.3
• Sequence Name: CBG23865
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; Ring finger domain; and Zinc finger, RING-type. Is an ortholog of C. elegans Y73C8C.3 and sdz-34.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23865a.1	CBG23865a.1		[unknown]
Transcript:CBG23865b.1	CBG23865b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23865b	CBG23865b		[unknown]
CDS:CBG23865a	CBG23865a		[unknown]

0 RNAi Result

13 Allele

• WBVar00036442
• WBVar00036412
• WBVar00036447
• WBVar00036417
• WBVar00036452
• WBVar00036422
• WBVar00036457
• WBVar00036427
• WBVar00036462
• WBVar00036432
• WBVar00036467
• WBVar00036437
• WBVar00036407

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1057147
• Remark: CBG17013, GAGTGTGCTCAAGAATGGTTCAAGACAAAGAGAACGTGTCCTGCATGCAGTTCAGCCCTT, WBGene00036790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term