WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037738 Gene Name  Cbr-unc-119
Sequence Name  ? CBG18291 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: GMP-PDE, delta subunit; Immunoglobulin E-set; GMP phosphodiesterase, delta subunit; and GMP phosphodiesterase, delta subunit superfamily. Is an ortholog of C. elegans unc-119. In C. elegans, unc-119 is involved in several processes, including body morphogenesis; dauer larval development; and regulation of multicellular organismal process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18291b.1 CBG18291b.1   [unknown]
Transcript:CBG18291a.3 CBG18291a.3   [unknown]
Transcript:CBG18291a.2 CBG18291a.2   [unknown]
Transcript:CBG18291a.1 CBG18291a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18291a CBG18291a   [unknown]
CDS:CBG18291b CBG18291b   [unknown]

0 RNAi Result

2 Allele

Public Name
st20000
nm67

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-unc-119, TTGACTTTGAATTCGGATTCTGTATTCCGAATTCACGAAACAACTGTGAACATATCTATG, WBGene00037738   Expr1053101 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term