WormMine: Gene WBGene00037738

• WormBase Gene ID: WBGene00037738
• Gene Name: Cbr-unc-119
• Sequence Name: CBG18291
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: GMP-PDE, delta subunit; Immunoglobulin E-set; GMP phosphodiesterase, delta subunit; and GMP phosphodiesterase, delta subunit superfamily. Is an ortholog of C. elegans unc-119. In C. elegans, unc-119 is involved in several processes, including body morphogenesis; dauer larval development; and regulation of multicellular organismal process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18291b.1	CBG18291b.1		[unknown]
Transcript:CBG18291a.3	CBG18291a.3		[unknown]
Transcript:CBG18291a.2	CBG18291a.2		[unknown]
Transcript:CBG18291a.1	CBG18291a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18291a	CBG18291a		[unknown]
CDS:CBG18291b	CBG18291b		[unknown]

0 RNAi Result

2 Allele

• st20000
• nm67

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053101
• Remark: Cbr-unc-119, TTGACTTTGAATTCGGATTCTGTATTCCGAATTCACGAAACAACTGTGAACATATCTATG, WBGene00037738
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term