Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG23494.1 | CBG23494.1 | [unknown] |
Other
10 Allele
Public Name |
---|
WBVar00027354 |
WBVar00027389 |
WBVar00027374 |
WBVar00027359 |
WBVar00027344 |
WBVar00027379 |
WBVar00027364 |
WBVar00027349 |
WBVar00027384 |
WBVar00027369 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG23494, CAGTTCCTTCCACTTAAGCCATGGATAAGAAGGTTCATCAACCATGTTTATTGGTCCATT, WBGene00041844 | Expr1050764 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |