Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG23328b.1 | CBG23328b.1 | [unknown] | |
Transcript:CBG23328a.1 | CBG23328a.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CBG23328a | CBG23328a | [unknown] | |
CDS:CBG23328b | CBG23328b | [unknown] |
6 Allele
Public Name |
---|
WBVar00035902 |
WBVar00035887 |
WBVar00035907 |
WBVar00035892 |
WBVar00035912 |
WBVar00035897 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG23328, GAATCGAGTGATTTTGCCACGTGGATCCATAACAATCCAGATATCGTCAGAAATGTTGCC, WBGene00041702 | Expr1070271 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CBG23327, AGGGAGAGCTGTAGATATGATATTCACACTTCCAGAAAACGATTTAGTAGAAACGATCGA, WBGene00041701 | Expr1055246 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |